Hum Genet 2009; 126: 707717. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. Although both broadly distributed, G2a-P15* and its downstream L91 sub-lineage have low frequencies, with the exception of Sardinia and Corsica. Its age is between 7,700 and . These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. PLoS One 2009; 4: e5792. Furthermore, markers Page94, U5, U8 and L30 were typed in contextually appropriate samples to establish the position of the five new markers within the phylogeny. Parallel evolution of genes and languages in the Caucasus region. The L141 mutation involves an insertion.[35]. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. G-M377, now also known as G2b1, has previously been designated G2b and G2c. [8][9], Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. Pichler I, Fuchsberger C, Platzer C et al. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. (a) Principal component analysis by population. See: Poznik. It was found with burial artifacts belonging to the Linearbandkeramische Kultur ("Linear Band Ceramic Culture"; LBK). In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. Am J Hum Genet 2012; 90: 573. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. AAL thanks the Sorenson Molecular Genealogy Foundation. Its chromosome location listed as 21653414. ), Ancient G-M201s with sequencing[self-published source?] Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. [24] Haplogroup G-M201 is believed to have been relatively absent during Neolithic India; the frequencies of the G2a-P15 subclade for example was negligible in indigenous Indian populations. The first principal component separates the populations of the Caucasus from those of Europe, with the Near/Middle Eastern populations being intermediate (Figure 3a). The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. and JavaScript. (Previously the name Haplogroup S was assigned to K2b1a4. L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. [20] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Am J Hum Genet 2000; 67: 15261543. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. Slider with three articles shown per slide. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined. Eur J Hum Genet 2004; 12: 855863. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. A plot of the sub-clades included in the principal component analysis (Figure 3b) indicates that the clustering of the populations from NW Caucasus is due to their U1* frequency, whereas L497 lineages account for the separation of central Europeans. The identification of a new SNP can necessitate renaming of one or more categories. The naming of sub-clades is according to YCC nomenclature principles. Haplogroup G ( M201) is a human Y-chromosome haplogroup. [42] The technical specifications of M201 are given as: refSNPid is rs2032636..Y chromosome location of 13536923.forward primer is tatgcatttgttgagtatatgtc..reverse primer is gttctgaatgaaagttcaaacg..the mutation involves a change from G to T. A number of SNPs have been identified with seemingly the same coverage in the population as M201. Lacan M, Keyser C, Ricaut FX et al. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. P257 was first reported in 2008. The Etruscans: a population-genetic study. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. Haplogroup G2a2b is a rare group today in Europe. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Hammer MF, Behar DM, Karafet TM et al. Herein . ISSN 1018-4813 (print), Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus, Subdividing Y-chromosome haplogroup R1a1 reveals Norse Viking dispersal lineages in Britain, Phylogenetic analysis of the Y-chromosome haplogroup C2b-F1067, a dominant paternal lineage in Eastern Eurasia, Y-chromosomal connection between Hungarians and geographically distant populations of the Ural Mountain region and West Siberia, Origin and diffusion of human Y chromosome haplogroup J1-M267, Bidirectional dispersals during the peopling of the North American Arctic, The role of matrilineality in shaping patterns of Y chromosome and mtDNA sequence variation in southwestern Angola, Ancient human mitochondrial genomes from Bronze Age Bulgaria: new insights into the genetic history of Thracians, Medieval Super-Grandfather founder of Western Kazakh Clans from Haplogroup C2a1a2-M48, Early medieval genetic data from Ural region evaluated in the light of archaeological evidence of ancient Hungarians, http://harpending.humanevo.utah.edu/popstr/, Population genetic study of 17 Y-STR Loci of the Sorani Kurds in the Province of Sulaymaniyah, Iraq, Phylogenetic history of patrilineages rare in northern and eastern Europe from large-scale re-sequencing of human Y-chromosomes, Sex-biased patterns shaped the genetic history of Roma, Middle eastern genetic legacy in the paternal and maternal gene pools of Chuetas, Cancel suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. Even more G SNPs were identified in 2009 to 2012 leading to more changes. Eur J Hum Genet 2010; 18: 348353. The frequency data were converted into isofrequency maps using the Surfer software (version 8, Golden Software, Inc., Golden, CO, USA), following the kriging algorithm using advanced options to use bodies of waters as breaklines. Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ : Y-chromosome diversity characterizes the Gulf of Oman. The P303 SNP defines the most frequent and widespread G sub-haplogroup. But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. Haplogroup G is a branch on the maternal tree of human kind. More distantly, G2a3a-M406 occurs in Italy (3%) with a Td of 8100 years ago, consistent with the model of maritime Neolithic colonization of the Italian peninsula from coastal Anatolia and/or the Levant. We attempted to localize the potential geographic origin of haplogroup G-M201 by considering those locations containing both G1-M285- and G2-P287-related lineages as well as the co-occurrence of high sub-haplogroup diversity. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. Although M527 frequency (Supplementary Table S1) is relatively low (16%), its phylogeographic distribution in regions such as southern Italy, Ukraine and the Levant (Druze and Palestinians) often coincides with areas associated with the Neolithic and post-Neolithic expansions into the Greek Aegean beginning approximately 7000 years ago.41 The expansion time (Td) of M527 is 71002300 years ago and is consistent with a Middle to Late Neolithic expansion of M527 in the Aegean. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). The Caucasus are today mainly the countries of Georgia, Armenia, Azerbaijan and southwestern Russia. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Am J Hum Genet 2008; 82: 873882. Goncalves R, Freitas A, Branco M et al. Zalloua PA, Xue Y, Khalife J et al. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. Peter A Underhill. In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. Two additional markers, DYS38829, 30 and DYS46131 were typed separately. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. Kayser M, Caglia A, Corach D et al. Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. CAS Ancient DNA suggests the leading role played by men in the Neolithic dissemination. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. Y-chromosomal diversity in Lebanon is structured by recent historical events. BMC Evol Biol 2011; 11: 69. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. Y-STR haplotypes were used to construct phylogenetic networks for haplogroups G-P303, G-P16 and G-M377, using the program Network 4.6.0.0 (Fluxus-Engineering, Suffolk, England, UK) and applying the median-joining algorithm. It has been found in Mexican mestizos. Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. The haplogroups contain many branches called subhaplogroups or subclades. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north. Using Y-STR data, the Td expansion time for all combined P15-affiliated chromosomes was estimated to be 150822217 years ago. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. Lacan M, Keyser C, Ricaut FX et al. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Origin. ), International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", Atlas of the Human Journey: Haplogroup G (M201), "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", https://haplogroup.info/all-ancient-dna-full.xlsx, "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. (Previously the name Haplogroup M was assigned to K2b1d. Haplogroup G (M201) is a human Y-chromosome haplogroup. The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. The hg G-U1 subclade is characterized by several sub-clusters of haplotypes, including a more diverse cluster mostly represented by Caucasus populations.
Lara Van Ruijven What Autoimmune Disease Did She Have,
White Pellets In Vomit,
Jon Richardson Favourite Musician,
Dbs Executive Director Salary,
Articles H